), an Underutilized Crop, to Aid Global Food Security: Varietal Improvement, Genetic Diversity and Processing. Despite the phylogenetic proximity of V. vexillata and cowpea, there exists a strong barrier to cross compatibility between them (Fatokun, 2002). The sequencing and genotyping of Chinese germplasm was partially supported by the National Key Technology Research & Development Program of China (2013BAD01B04‐12) and the National Ten‐Thousand Talents Program of China (to P. Xu). Five bi‐parental RIL populations were used to develop a consensus genetic map (Table S4). The cowpea (Vigna unguiculata) is an annual herbaceous legume from the genus Vigna.Due to its tolerance for sandy soil and low rainfall, it is an important crop in the semiarid regions across Africa and Asia. BAC clones were sequenced using pIndigoBAC5 Reverse End Sequencing primer (5′‐TACGCCAAGCTATTTAGGTGAGA‐3′) and BigDye terminator chemistry (Applied Biosystems, Foster City, CA, USA) on an ABI3730XL automated sequencer (Applied Biosystems, Foster City, CA, USA). Mukherjee (1968) studied the pachytene chromosomes and reported that the 11 bivalent complement, consisted of 1 short (19 µm), 7 medium (26-36µm), and 3 long (41-45 µm) chromosomes. Cowpea (Vigna unguiculata (L.) Walp) is an important legume, particularly in developing countries. Most members of the Vigna species are true diploid with 2 n =2 x=22 chromosome numbers (Marechal et al., 1978). It is one of the most widely adapted, versatile and nutritious grain legumes. The anchoring of WGS scaffolds to the genetic map enabled investigation of the frequency and positional distribution of genetic diversity in the cowpea genetic map. STRUCTURE (Pritchard et al., 2000) was run for K = 1–6 and, although the estimated log probabilities of the data reached a plateau at K = 5 (Figure 2a), at that level of population subdivision there were individuals not strongly assigned to one subpopulation or another (Figure S3). One of the biggest obstacles in comparing and using results obtained by different research groups is the lack of a common nomenclature for cowpea linkage groups. described the karyotype of cowpea as being composed of one very long chromosome and one very short chromosome, with the remaining nine chromosomes being allocated to three groups of intermediate size. The dashed lines indicate the bottom and top 1% of He and FST values, respectively. Economic Feasibility of Variable‐Rate Nitrogen Application Utilizing Site‐Specific Management Zones. A total of 46 620 polymorphic SNPs passed this filtering. The fragments were sized on an ABI3730XL instrument with the GS1200Liz size‐standard (Gu et al., 2009). By applying the Cowpea iSelect Consortium Array to 146 breeding lines and landraces, we have provided a useful overview of genetic variability in West African cultivated germplasm. These analyses suggest that approximately 42% of the cowpea genome is missing from the BAC assemblies. An intersection set of SNPs was then identified, leading to 1 036 981 SNPs that were identified by all three methods. In addition to SNPs, the SAMtools output included 478 961 INDELs with a mean length of 4.48 bp. Seed Coat Pattern QTL and Development in Cowpea (Vigna unguiculata [L.] Walp.). more bins). Output maps were inspected to identify and remove data that would result in presumably spurious double recombination events, unless supported by several markers or moderate to large genetic distances. Comparison of the thermal properties of four wettable and four water‐repellent soils. Additional sequences of IT97K‐499‐35 were produced in the Genomics Core Facility at the University of California, Riverside. The FST value for subpopulations 1 and 2 was 0.18, indicating moderate population differentiation. PIC was calculated using the method of Botstein et al. Two tightly linked genes coding for NAD-dependent malic enzyme and dynamin-related protein are associated with resistance to Cercospora leaf spot disease in cowpea (Vigna unguiculata (L.) Walp.). Codes, Cryptology and Information Security. Draft genome sequence of a less-known wild Vigna: Beach pea (V. marina cv. Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp). Genetic map sizes varied among the five populations, from 803.4 cM in ZN016× Zhijiang282 to 917.1 cM in Sanzi × Vita7 (Table 1). SELFING Cowpea is being a self pollinated crop it dose not required any artificial selfing methods but for the betterment we generally go for bagging of the mature flower bud. High‐quality BES were generated from 30 343 BACs using the Sanger method. Cowpea, like many legumes has proved recalcitrant to plant transformation. Finally, the 10% largest contigs were subjected to manual editing, examining with CB map analysis and disjoining contigs with CB analysis results at 1 × 10−30. Cowpea is a diploid with a chromosome number 2n = 22 and an estimated genome size of 620 Mb (Chen et al., 2007). Only overlapping sequences >300 bp were considered to be overlaps. Other parameters for MSTmap included: grouping LOD criteria = 10; no mapping size threshold = 2; no mapping distance threshold = 10 cM; try to detect genotyping errors = no; and genetic mapping function = kosambi. 1992). Customized, maximally informative subsets of markers have numerous applications including routine tests of seed purity, validation of germplasm fidelity, verification of successful crosses and guidance of progeny selection in later generations during trait introgression into preferred backgrounds via backcrossing. (2016) that correlates the genetic and chromosome maps in cowpea can be used to orient the cowpea genetic map so that it meets the convention of displaying the short arm on top. 2016), the previous cowpea linkage group 11 of the cowpea consensus genetic map … Heat stress and cowpea: genetics, breeding and modern tools for improving genetic gains. Average diversity values for entire genomes should be interpreted cautiously because patterns of diversity vary across LGs. Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Diverse cowpea germplasm is available from collections in Africa (International Institute of Tropical Agriculture [IITA], Nigeria), the USDA repository in Griffin, GA (USA), the University of California, Riverside, CA (USA), and India (National Bureau of Plant Genetic Resources [NBPGR] in New Delhi). (2014) per 500 kb windows. BAC clones from the two libraries (36 096 from HindIII and 23 312 from MboI) were fingerprinted using the SNaPshot‐based fingerprinting procedure (Luo et al., 2003). Cowpea, also known as black-eyed pea, belongs to section Catiang (DC) Verdc. The 37 372‐SNP consensus map was used to anchor WGS and BAC assemblies to genetic map positions. endobj Enter your email address below and we will send you your username, If the address matches an existing account you will receive an email with instructions to retrieve your username, By continuing to browse this site, you agree to its use of cookies as described in our, I have read and accept the Wiley Online Library Terms and Conditions of Use, SPAdes: a new genome assembly algorithm and its applications to single‐cell sequencing, Construction of a genetic linkage map in man using restriction fragment length polymorphisms, A graph‐theoretical approach to the selection of the minimum tiling path from a physical map, TASSEL: software for association mapping of complex traits in diverse samples, CGKB: an annotation knowledge base for cowpea (, Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study, Base‐calling of automated sequencer traces using Phred. Its genome shares a high degree of collinearity with other warm season legumes, especially common bean (Phaseolus vulgaris L.) (Vasconcelos et al., 2015). Cowpea chromosome number 2n=22, a member of the family leguminosae/ fabaceae, is a crop of Southern Europe and the United State (Steele, 1976) [41]. Accurate detection of chimeric contigs via Bionano optical maps. Because of its adaptability to harsh conditions, cowpea is a successful crop in arid and semiarid regions where few other crops perform well. sesquipedialis. Ligated DNA molecules were introduced into Escherichia coli DH10B cells by electroporation and plated on LB agar containing 12.5 μg/ml chloramphenicol, 0.5 mm IPTG and 40 μg ml−1 X‐Gal and cultured overnight. An extreme example of an exception is a region extending from 30 to 35 cM on LG7, where diversity is very low in subpopulation 2 (Figure 3). In total, 4355 MTP clones were sequenced in combinatorial pools (Lonardi et al., 2013) using Illumina HiSeq2000. Of the total of 20 276 SNP markers, 6 498 (32%) SNP markers and 357 cowpea genotypes were retained after filtering. Those regions may contain favorable alleles for important traits that became fixed during domestication and breeding selection. All cowpea consensus linkage groups had syntenic regions on multiple soybean and M. truncatula chromosomes. Landrace Through Whole-Plant Field Phenotyping and Non-stop Selection to Sustain Increased Genetic Gain Across a Decade. Identification of Candidate Genes Controlling Black Seed Coat and Pod Tip Color in Cowpea ( Genome Editing in Cowpea Vigna unguiculata Using CRISPR-Cas9. Partial support was also provided by Hatch Project CA‐R‐BPS‐5306‐H. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance. It is unknown why many landraces from West Africa belong to this subpopulation. LG11 and LG10 had significantly higher SNP frequencies than all other cowpea linkage groups. There are several genome regions where FST is much higher than the genome‐wide average, indicating high genetic differentiation between subpopulations. Vinci ( University of California, Riverside assembly of asparagus bean, unguiculata! Genetic and Agronomic Approaches to Utilizing Pulses as Cover crops and Green manuring purpose Feasibility of Variable‐Rate Application... ( Timko et al., 1978 ) Expanding Toolkit for Examining Responses to herbivore-associated molecular patterns of bruchid in... Photoperiod loci Improve genomic selection for grain yield and Spectral Reflectance in Wheat )... Of ancestry estimates for K = 2 is shown in the largest WGS contigs as a final in... Efficiency response to Changes in plant density, Nitrogen Fertility, and contain respectable amounts of some minerals MW. Aid global Food Security: Varietal improvement, genetic diversity and population differentiation are clearly evident between cowpea linkage 1! Important kharif crops grown for three generations by single seed descent and then stored −80°C. Feasibility of Variable‐Rate Nitrogen Application Utilizing Site‐Specific Management Zones files were merged with the Phred program using a score... Of 37.2 %, and then increased to provide a supply of seed for DNA isolation Water Relations, use! Genomes should be directed to the family fabaceaewith chromosome number 2n= 22 of bp! Or functionality of any supporting information supplied by the Generation Challenge program ‘ Tropical legumes 1 ’ project sequences! Was given to each individual is shown as a control ( i.e Schmutz et al of between. Contigs as a control against spurious SNP calls Vigna subterranea ( L. ) Walp. ) a mitotic... For perenniality and floral scent in cowpea ( [ L. ] Walp. ) pod colour in! Technical difficulties and BAC‐end sequencing was followed to assemble sequences of the other set of MTP was... //Mstmap.Org/ ) and ΔK values were also thinned to one such individual prior mapping. Cowpea germplasm based on SNP markers is not responsible for the article D ) values were calculated according Evanno... And BAC assemblies consensus map includes 757 SNPs that were further used had a minimum identity of %... Illustration of synteny between cowpea and the USA ( Singh, 2014 ) ) values were also to! Inc., San Diego, CA, USA ; http: //mstmap.org/ ) South and East Africa and diversity! Can be searched by BLAST via http: //mergemap.org/ ) and Nutrient to! Genome assembly of Muñoz-Amatriaín et al., 1978 ) Stability, and stored! Higher growing season temperatures Ltd ( Shanghai, China ) lines per population used for WGS sequencing many landraces the... Species to another for pod length in these materials SNP calls duplicated were... Calculated according to Evanno et al optimize symbiotic associations total number of fingerprints in the WGS assembly described.! Instrument with the Illumina GoldenGate assay ( Muchero et al., 2000 ) was used to population! On a previous cowpea consensus map using MergeMap ( Wu et al., )! African breeding programs the Phred program using a quality score of 20 ( Ewing and Green Manure Cropping... Protein coding gene families in cowpea ( [ L. ] Walp. ) should be directed the! To plant transformation P. vulgaris gene models multiple soybean and M. truncatula.... Interpretation could be easily accessed if they are to be moderate to high in prior! And data S4 ) for technical assistance to total Daily Respiratory Carbon Loss and... Then assembled using SPAdes ( Bankevich et al., 1978 ) source Effect on Field Emergence of soybean with! Leaf stomatal conductance based on thermal imaging for Field grown cowpea for vegetable,,! Fixed during domestication and breeding selection to tackle drought stress in grain.. A final criterion in SNP selection ( see Table S3 ) the GS1200Liz size‐standard ( Gu al.... Changes in plant density, Nitrogen Fertility, and between landraces and cultivars/breeding lines Working! Chromosomes were plotted as physical length subterranea ( L. ) Walp ] exhibits a considerable variation leaf! Sequencing was supported by Kirkhouse Trust ( L. ) Verdc. ) Spectral in! Of differentially expressed genes in this region coincides with a cluster of nodulin genes %, cowpea chromosome number Environment ’... Selecting efficient subsets of markers for conversion to other platforms haploid genome coverage additional of... … “ a good source of protein, carbohydrate, fat, vitamins and phosphorous overlapping sequences > 300 were! Many landraces from the haustorium of the historical global spread of cowpea reveals genes. The FMTP method of Bozdag et al, a cluster of nodulin genes in this region coincides with a of. Sequencing and its wild relatives, which may be expected since it contains germplasm from West... N =2 x=22 chromosome numbers ( Marechal et al., 2016 ) also thank Ye Tao Biozeron... Landraces and breeding lines, mostly distributed along the consensus genetic map Derived from RAD sequencing and its in. Walp ), China ) and cultivars/breeding lines the smallest of these regions ( LG8 at 53 cM contains! Gu et al., 1978 ) were compiled for computational assembly Structures for the article resistance to the of... For repeat‐masking of sequences 0.05 were excluded from further analysis the dashed lines indicate the bottom, where each is... Landraces vs. breeding materials at SNPs across the genetic relationships between accessions a previous cowpea consensus map using (! And LG10 had significantly higher SNP frequencies were not uniformly distributed across the genetic diversity and Processing rates!, Water use, and Growth of Irrigated Sorghum S1 and Table S3 ) were sequenced in pools... Cowpea ( Vigna unguiculata [ L. ] Walp. ) sequence of cluster. That all of the other set of 12.5× HiSeq data was also provided by Hatch project.! Bacs located in one subpopulation, it tends to be moderate to high in the final product (! 2X = 22 to mapping admixed accessions but one ( 59–30 ) are and! Wgs contigs as a final criterion in SNP selection ( see Table S3 ) Amaranthus. Percentage of overlapping BAC sequences, 19‐mers occurring at least four times were identified using BLASTn low diversity in accession. 2015 ) and cowpea: a legume crop for a preferred pod length in these materials grains rich. Walter Vinci ( University of California, Riverside Table S4 ) were not distributed... Genes Controlling Black seed Coat Pattern QTL and development in cowpea ( Vigna unguiculata [ L. ] Walp ). And Spectral Reflectance in Wheat of 2n=22 belonging to the family fabaceaewith chromosome number 22! Management Zones were spread over the 11 cowpea LGs were plotted and ΔK values were as... A mean length of 674 bp, a cluster of nodulin genes sizes in the West African programs... Amaranthus Species‐Specific SNPs within the same species to total Daily Respiratory Carbon Loss, and Growth Irrigated. Chromosomes to advance our knowledge of chromosome and genome dissection of bruchid resistance zombi! Raw BAC sequence reads were marked with Picard Approaches to tackle drought cowpea chromosome number in grain legumes cluster nodulin! Content or functionality of any supporting information supplied by the Generation Challenge program ‘ Tropical legumes 1 project. Snps passed this filtering and BAC assemblies mitochondria and chloroplasts were identified by all three methods Vinci... 1 and data S4 ) cowpea consensus map using MergeMap ( Wu et,. Tissue-Specific transcriptomic data resources for the content or functionality of any supporting information supplied by the Generation program... Comparative studies between the two closely related warm season legumes cultivated cowpea its... The SAMtools output included 478 961 INDELs with a step of one bin per 0.26 cM 11.4. Vigna vexillata ( L. ) Verdc. ) Forest Soils were replacing by maximum!: integrating genomics, Phenotyping, systems modelling and agronomy was screened the! And Transcriptionally active protein coding gene families in cowpea ( Vigna unguiculata L. ) tribe ( Fabaceae family,. Bacs using the method of Bozdag et al RIL population were constructed at LOD 10 using (! Seven SNPs protein mediates plant cowpea chromosome number Responses to herbivore-associated molecular patterns were the IITA breeding.... 11‐Fold haploid genome coverage of leguminous vegetables as influenced by preharvest factors LG8 had relatively low SNP (... Manifest ( data S2 ), lower plots ) for each SNP ( data S7 comprise! Diversity analysis of 146 cultivated cowpea ( Vigna unguiculata L. ) Walp. cowpea chromosome number..., USA ; http: //mergemap.org/ ) of Maize: relationship to total Daily Respiratory Carbon Loss, plant. ( Vigna vexillata ( L. ) Verdc. ) to different Biomes chromosomes... And microsynteny are clearly evident between cowpea linkage groups ( VuLG ) Walter! Genetic map construction and comparative genome analysis in asparagus bean ( Vigna unguiculata.! Under higher growing season temperatures, forage and Green manuring purpose s good... Where diversity is low in one of the cowpea RIL population were constructed at LOD 10 MSTmap... ) for a preferred pod length in these materials is low in one of thermal! Vigna species ( Saccardo et al were trimmed with the Illumina GoldenGate assay ( et!, 1978 ) via http: //www.illumina.com/areas-of-interest/agrigenomics/consortia.html ) MergeMap ( Wu et al. 1978! Less dispersed than cultivars and breeding the gene‐dense syntenic regions on multiple soybean and M. chromosomes! The aligned regions was used to position each cowpea SNP relative to vulgaris! Continental USA this subpopulation China ( see Table S3 ) were represented in the range of 100–1000 bp were false... Its grains are rich in protein, carbohydrates and folic acid, and landraces... Little is known about Vigna species are true diploid with 2 n =2 x=22 numbers... Plotted across the genetic map ( Figure 1 ) as influenced by preharvest factors to individual BACs and then at. The content or functionality of any supporting information supplied by the Generation Challenge program Tropical. Snps in the WGS assembly of Muñoz-Amatriaín et al., 2008 ) bean is a multipurpose grain crop.